Body Mass Index in Pregnancy Does Not Affect Peroxisome Proliferator‑activated Receptor Gamma Promoter Region (−359 to −260) Methylation in the Neonate

  • VRE Casamadrid
  • CA Amaya
  • ZH Mendieta
Keywords: Body mass index, Methylation, Peroxisome proliferator‑activated receptor gamma, Pregnancy

Abstract

Background: Obesity in pregnancy can contribute to epigenetic changes.

Aim: To assess whether body mass index (BMI) in pregnancy is associated with changes in the methylation of the peroxisome proliferator‑activated receptor γ (PPAR) promoter region (−359 to − 260) in maternal and neonatal leukocytes.

Subjects and Methods: In this matched, cohort study 41 pregnant women were allocated into two groups: (a) Normal weight (n = 21) and (b) overweight (n = 20). DNA was extracted from maternal and neonatal leukocytes (4000–10,000 cells) in MagNA Pure (Roche) using MagNA Pure LC DNA Isolation Kit 1 (Roche, Germany). Treatment of DNA (2 μg) was performed with sodium bisulfite (EZ DNA Methylation‑Direct™ Kit; Zymo Research). Real‑time quantitative polymerase chain reaction (qPCR) was performed in a LightCycler 2.0 (Roche) using the SYBR® Advantage® qPCR Premix Kit (Clontech). The primers used for PPARg coactivator (PPARG) M3 were 5’‑aagacggtttggtcgatc‑3’ (forward), and5’‑cgaaaaaaaatccgaaatttaa‑3’ (reverse) and those for PPARG unmethylated were: 5’‑gggaagatggtttggttgatt‑3’ (forward) and 5’‑ttccaaaaaaaaatccaaaatttaa‑3’ (reverse). Intergroup differences were calculated using the Mann–Whitney U‑test, and intragroup differences, with the Wilcoxon test (IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY: IBM Corp.).

Results: Significant differences were found in BMI, pregestational weight, and postdelivery weight between groups but not in the methylation status of the PPARγ promoter region (−359 to − 260).

Conclusion: The PPARγ promoter region (−359 to − 260) in peripheral leukocytes is unlikely to get an obesity‑induced methylation in pregnancy.

Keywords: Body mass index, Methylation, Peroxisome proliferator‑activated receptor gamma, Pregnancy

Published
2016-04-20
Section
Articles

Journal Identifiers


eISSN:
print ISSN: 2141-9248