Author Guidelines
ZVJ Guide for Authors – Contents:
1. General Information
2. Copyright, Licensing, and Publication Rights
3. Originality, Plagiarism, and Use of Artificial Intelligence
4. Types of Articles
5. Manuscript Preparation
6. Supplementary Material
7. Pre-submission Checklist
8. Peer Review Process and Manuscript Revision
9. After Acceptance
Reprints and Offprints
• Permissions
10. Privacy Statement
11. Article Processing Charges (APC)
12. Contact information
1. General Information
- Zagazig Veterinary Journal (ZVJ) is the official peer-reviewed scientific publication of the Faculty of Veterinary Medicine, Zagazig University, Egypt. The journal welcomes high-quality submissions from researchers and academics both nationally and internationally.
- ZVJ aims to disseminate original research, reviews, and scholarly articles in all areas of veterinary medicine, including epidemiology, public health, livestock welfare, vaccinations and medication, biotechnology, and bioinformatics, while ensuring authors benefit from an efficient and consistent editorial process.
- ZVJ adheres to the ethical and editorial standards set forth by the COPE .
- Only original manuscripts that have not been published or submitted elsewhere will be considered. Any form of unethical publishing practice—such as plagiarism, duplicate submission, improper authorship, or undisclosed conflicts of interest—is strictly prohibited (please refer to the publication ethics before submitting the article).
- Manuscripts must be written in clear, grammatically correct English and should be thoroughly checked for spelling and language accuracy prior to submission.
- Submission process: All manuscripts must be submitted through the journal’s online submission platform ( Zagazig Veterinary Journal - Login ). Authors must create an account on the system, follow the steps for “manuscript submission,” and upload all relevant files in accordance with the instructions outlined in the Manuscript Preparation The system will automatically generate a PDF version for peer review. Editable files (e.g., Microsoft Word) will be required for final production. All editorial correspondence, including decisions and revision requests, will be conducted via email.
- Details regarding article processing charges (APC) and any additional applicable fees are
communicated directly to authors and are reviewed periodically.
2. Copyright, Licensing, and Publication Rights
Zagazig Veterinary Journal is published under the Creative Commons CC BY-NC-ND license ( https://creativecommons.org/licenses/ ) which permits the copying and distribution of its articles in any medium or format in their original form, for non-commercial use, with proper attribution to the original authors and retain their copyright. Authors retain the copyrights and transfer only the commercial rights to the publisher (Zagazig University). For more details, please visit the journal Publication Ethics
3. Originality, Plagiarism, and Use of Artificial Intelligence
Submissions should be original works. When authors include content or phrasing from other sources, they need to make sure it's properly cited or quoted. Authors are required to address any copyright concerns when referencing figures or tables from other publications.
To ensure originality, Zagazig Veterinary Journal automatically screens all new submissions for plagiarism using Crossref Similarity Check (powered by iThenticate) within its editorial system. If the similarity index exceeds 20%, the Editor contacts the corresponding author, providing the plagiarism report to facilitate revisions of the plagiarized text.
ZVJ prohibits the use of generative AI and AI-assisted technologies in manuscript preparation. Authors are required to submit a “Declaration on the use of AI in the writing process” affirming that their work’s content, ideas, or theories were not generated using such tools.
4. Types of Articles
Zagazig Veterinary Journal (ZVJ) accepts a variety of manuscript types that contribute significantly to the advancement of veterinary medical sciences and related disciplines. The journal welcomes submissions of high scientific and ethical quality, including but not limited to the following categories:
a) Original Research Articles
These articles present novel research findings that contribute to the advancement of veterinary sciences and allied fields.
- Word limit: These should not be less than 3500 words and should not exceed 6000 words
(including references, tables, figure legends) - It should be organized in the following sections: Title page, Abstract, Introduction, Materials and methods, Results, Discussion (or Results and Discussion), Conflict of Interest, Acknowledgments, References, Arabic Abstract.
- Abstract: Structured (Background, Methods, Results, Conclusion), not less than 150 words and should not exceed 300 words
b) Review Articles
Reviews should provide a critical and up-to-date synthesis of existing literature on relevant topics in veterinary science which are of broad interest to the target audience of the journal. These are usually invited, but authors identifying a need and wishing to submit a review article are welcome to contact the Editorial Office.
- Authors are advised to contact the Editorial Office before the commencement of writing to ensure that a similar topic has not already been commissioned to another Author.
- Word limit: Should not exceed 9000 words including references.
- Abstract: not less than 150 words and should not exceed 300 words
- Figures/Tables: Should complement the text without excessive duplication
c) Case Studies / Case Reports
Detailed reports describing unique or rare clinical veterinary cases, innovative treatment approaches, or novel diagnostic methods.
- Word limit: Should not exceed 1,000.
- Abstract: not less than 150 words and should not exceed 300 words
- References: no more than 10 references
- Figures/Tables: Only one table or figure
d) Short Communications
Brief reports on preliminary or time-sensitive research findings of scientific relevance to the veterinary field.
- Word limit: Should not exceed 2000 words including references.
- Abstract: not less than 150 words and should not exceed 300 words
- References: 10 references
- Figures/Tables: No more than two tables, two figures
5. Manuscript Preparation
Authors submitting manuscripts to Zagazig Veterinary Journal (ZVJ) are expected to adhere to the following preparation guidelines to ensure a smooth and standardized editorial process:
Cover Letter
Each manuscript must be accompanied by a cover letter including:
- Author Information: Clearly state the full names (first and last), institutional affiliations, and countries for all authors. Ensure accurate spelling of names and complete institutional details.
- Corresponding Author: Identify the author responsible for all communication during the review and publication process. Include an up-to-date email address and confirm their commitment to responding to future inquiries regarding the study's methodology or data.
- Submission Declaration: Confirm that the manuscript is submitted exclusively to Zagazig
Veterinary Journal, has not been published or submitted elsewhere, and that all listed authors have contributed to the work and approved the final version.
Formatting Requirements
- Manuscripts should be prepared using word processing software, formatted in a single column, with 2.5 cm margins on all sides.
- Use Times New Roman, 12-point font, with double line spacing throughout the document.
- All pages must be numbered consecutively, and lines must be numbered continuously from the beginning to the end of the manuscript to facilitate the peer review process.
Manuscript Structure
The main text should be arranged in the following sequence:
- Title Page
- Abstract
- Introduction
- Materials and Methods
- Results (Including Tables and Figures)
- Discussion
- Conflict of Interest Statement
- Acknowledgments
- References
- Arabic Summary
- Abbreviations, Symbols and Nomenclature
Title Page
- The Title Page is submitted separately from the manuscript during the online submission.
- The title page should include the title of the manuscript as well as the full names and institutional affiliations for all authors. The corresponding author should also be indicated (provide address and email).
- Title: The title should contain no more than 150 characters (including spaces) and should be specific to the study. It should be comprehensible to a broad spectrum of readers.
- Running Title: Should not exceed 40 characters.
- Authors and Affiliations: This section should include the first names, middle initials (if used), surnames, and affiliations (university or organization), department, city, state/province (if applicable), and country for all authors. The institution/laboratory where the work was conducted should be indicated. One of the authors should be designated as the corresponding author. Full contact details including postal address, telephone and fax numbers, and email address for the corresponding author must be provided.
- The Manuscript: The names and affiliations of the authors should NOT be included in the
manuscript file.
Abstract
- The abstract must be not less than 150 words and should not exceed 300 words. Citations, tables and abbreviations should be avoided. The techniques used must be mentioned without going into methodological detail and the most important findings should be summarized.
- Key words: The authors must provide 3-5 keywords separated by semicolons or commas.
Introduction
- The introduction should be concise and be written in a way understandable to researchers without specialist/expert knowledge in the area. Relevant controversies or disagreements in the field should be mentioned.
- The introduction should conclude with a comment about the overall aims of the study.
Materials and Methods
- This section should include the study design, setting, materials involved, as well as a description of all interventions and comparisons. The authors should also provide a description of the type of statistical analysis used, including a power calculation when appropriate.
- Well-established methodologies should simply be mentioned and referenced appropriately. For new methods, the protocols for the method should be included. Generic drug names should generally be used and in cases where proprietary brands have been used, the brand names must be included in parenthesis.
- Where available, the accession numbers of any nucleic acid sequences and protein sequences cited in the manuscript and the corresponding database name should be provided.
- When referring to a manufacturer with reagents or equipment used, the city and country where the manufacturer is located should also be provided.
Results
- The results section should be written in past tense and should provide details of findings that are required to support the manuscript's conclusions. To enhance clarity, the section may be divided into subsections, each with a concise subheading.
- Where appropriate, statistical analysis results should include analysis of relative/absolute risks and confidence analysis.
- Large datasets, including raw data, may be submitted as supporting files for publication
as supplementary appendices. - The author should refer to the Table/Figure number after the relevant description in the results section.
Discussion
- The discussion should clearly identify the main conclusions of the study. Authors should provide a clear explanation of the importance and relevance findings.
- Speculations on how the conclusions fit in or affect the existing assumptions or models should be explored.
- Suggestions for further key experiments for future work can be included.
- When appropriate, issues related to resource limitations faced by the researchers during the course of the study, how these were addressed, and suggestions for improvement may also be included.
Conflict of interest
ZVJ requires that all authors disclose any potential sources of conflict of interest. Any interest or
relationship, financial or otherwise, that might be perceived as influencing an author’s objectivity is considered a potential source of conflict of interest. If the authors have no conflict of interest to declare, the authors must state “None of the authors have any conflict of interest to declare.”
Acknowledgments
Those who have made a substantial contribution to the study in terms of design, execution, analysis or manuscript drafting/revision but do not fit the criteria for authorship should be mentioned in this section. It is the responsibility of the authors to ensure that those being acknowledged have agreed to being named in such capacity. The source of funding for the study should be stated in this section.
References
- ZVJ uses the numbered citation method.
- The references must be listed and numbered consecutively in the order in which they appear in the text.
- Citations should be indicated by their unique reference number in square brackets in the text. Where there are multiple citations within a single set of brackets these should be separated by commas without space.
- If there are three or more sequential citations, the numbers should be given as a range. Example: “……. [1,6-8,26]”
- Personal communication and unpublished data should be avoided.
Reference format examples:
Papers Published in journals
Hanson, B.M.; Dressler, A.E.; Harper, A.L.; Scheibel, R.P.; Wardyn, S.E.; Roberts, L.K.; Kroeger, J.S. and Smith, T.C. (2011): Prevalence of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus (MRSA) on retail meat in Iowa. J Infect Public Health, 4: 169-174.
Papers In Press
Kharitonov, S.A. and Barnes, P.J. Clinical aspects of exhaled nitric oxide. Adv Clin Path. In press.
Books
- Whole Book
Lucas, A.O. and Gilles, H.M. (2003): Short textbook of public health medicine for the tropics, 4th edition. London: Arnold Press 389 p.
- Book Chapter
Fernández, E. and Torres, A.C. (2006): Gender differentials in health. In Jamison, D.T.; Bremen, J.G.;
Measham, A.R.; Alleyne, G.; Cleason, M.; Evans, D.B.; Jha, P.; Mills, A. and Musgrove, P. editors. Disease Control Priorities in Developing Countries. New York: Oxford University Press. 195-210.
For EndNote users:
The file below includes the EndNote style of the journal for direct export, please click here
Arabic Summary
An Arabic summary of the English abstract should be included at the end of the manuscript. The Arabic summary should match all the information and details highlighted in the English abstract. The count of Arabic summary words is not included in the total count of the manuscript.
Abbreviations, Symbols and Nomenclature
- All specifications must be stated according to the S.I. system. Concentration of chemical solutions are to be given in mol/l. All other concentrations should be given in % (volume or weight). Any abbreviations of chemical, biological, medical or other terms should only be employed when it is certain that they are internationally known. The full name must be stated in brackets when the abbreviation is first used.
- All biological, medical, chemical or other terms should be used according to the most recent
recommendations of the respective international nomenclature. Enzymes should be provided in I.U. (International Units), according to Enzyme Nomenclature (Elsevier Publishing Co., 1965). In the case of commercially obtained substances or reagents, when they are first mentioned in the text, the name and address of the manufacturer or supplier should be given as a footnote. Products (preparations etc.) with a registered trademark should be marked with. - Bacterial names should be in accordance with the latest edition of Bergey's Manual of
Determinative Bacteriology (The Williams and Wilkins Co., Baltimore). Viruses are to be given the classification and names recommended by the International Committee on the Nomenclature of Viruses. - Names of micro-organisms and zoological names should be in italics in the manuscript.
Tables
- Submit each table with its title, in the Main Manuscript word file.
- Use Arabic numerals to number tables. Details of experimental conditions should be included in the table footnotes.
- Tables must be prepared using the same word processing package as the manuscript text.
- Tables must not include ruled vertical or horizontal lines except for headers and footers.
Example for Tables
Table 1: Primer sequences and expected product sizes of the multiplex PCR
Gene Primer sequence (5’à3’) Expected product size (bp)
inlA1 inlA-Forward ACGAGTAACGGGACAAATGC 800 bp
inlA-Reverse CCCGACAGTGGTGCTAGATT
inlC2 inlC-Forward AATTCCCACAGGACACAACC 517 bp
inlC-Reverse CGGGAATGCAATTTTTCACTA
inlJ3 inlJ-Forward TGTAACCCCGCTTACACAGTT 238 bp
inlJ-Reverse AGCGGCTTGGCAGTCTAATA
1The inlA primers were intended for species-specific recognition, and the 2inlC and 3inlJ primers were designed for virulence determination of L. monocytogenes.
Figures
- Figures and Figure legends should follow the References in the manuscript file and the Figures should also be in a separate electronic file (tif or jpg).
- They should be numbered consecutively using Arabic numerals (Figure1, Figure 2, Figure 3).
6. Supplementary Material
- Authors may provide supplementary files that offer additional content supporting the main findings of the manuscript. These materials are intended for online publication only and should enhance, but not duplicate, the information presented in the core article.
- Supplementary content may include, but is not limited to, extended datasets, additional figures or tables, video clips, detailed methodologies, or multimedia files that provide further context or depth. All supplementary items must be clearly cited within the main text and labelled appropriately.
- To ensure proper evaluation, supplementary materials must be submitted at the same time as the main manuscript and will be considered as part of the peer review process. Each file should be accompanied by a brief and informative caption that accurately describes its content.
- Please note that these materials will be published as received, without any further editorial
formatting or typesetting. Therefore, authors bear full responsibility for the accuracy, clarity, and presentation of all supplementary files.
7. Pre-submission Checklist
Prior to submitting your manuscript to Zagazig Veterinary Journal (ZVJ), authors are advised to ensure the following criteria are met, in order to facilitate a smooth and timely review process:
- All required submission files — including the complete manuscript and cover letter — have been properly uploaded.
- The cover letter contains the full name, institutional affiliation, postal address, email, and phone number of the corresponding author, who is responsible for communication throughout the editorial process.
- The manuscript is complete and follows the journal’s formatting and structural requirements.
- Keywords (3–6) are provided directly after the abstract.
- All tables and figures are included, each with appropriate titles, legends, and footnotes as needed.
- All tables and figures are properly cited within the main text.
- The manuscript has been checked for correct spelling, grammar, and clarity of expression.
- All references cited in the text are listed in the References section, and vice versa.
- A conflict-of-interest statement is included, even if there are no conflicts to declare.
- The journal’s editorial policies and submission guidelines have been reviewed and adhered to.
Authors are encouraged to treat this checklist as a mandatory step before submission to avoid unnecessary delays during peer review.
8. Peer Review Process and manuscript revision
The manuscript will be sent to two reviewers who will be asked to assess whether the manuscript is technically and scientifically sound, coherent and with acceptable writing quality. The final editorial decision will be based on the recommendations of the peer reviewers in a double-blind way, provided these recommendations are in accord without any strong dissenting opinions. Where there are dissenting or opposing views, the paper is assessed by a third reviewer who may or may not be a member of the journal’s Editorial Board. Once all reviews have been received and considered by the editors, a final decision will be sent to the corresponding author.
9. After Acceptance
- English language editing: Final English language editing will be done by experts after receipt of the article-processing charge.
- Proof Corrections: The corresponding author will receive an e-mail containing PDF. A working e-mail address must, therefore, be provided for the corresponding author. The proof can be downloaded as a PDF (portable document format).
- Proofs must be returned to the Editor within two days of receipt with corrections if any. If there is no correction, then the corresponding author must have to reply accordingly. We ask that you only correct typesetting errors and grammatical errors if any. Please note that the author is responsible for all statements made in their work, including changes made.
- Reprints and Offprints: Hard copies (current or archived) issues can be delivered upon request with the appropriate cost according to the number of pages, copies and transportation.
- Online publication and reprints: Author can download the PDF from the site. Reprints (hard copy) can be sent by post on request by the author, or they can be collected from the Editorial office. Online articles are complete and final. They have been fully reviewed, revised and edited for publication, and the authors' final corrections have been incorporated. We do assign DOI to each newly published article.
Permissions
- Authors are responsible for obtaining the necessary permissions for any content reproduced or adapted from previously published materials, including figures, tables, images, or extended quotations.
- A formal written authorization from the copyright holder must be provided, granting Zagazig Veterinary Journal (ZVJ) the right to use such material within the submitted manuscript. Failure to secure and submit the appropriate permissions may result in delays or rejection of the manuscript.
10. Privacy Statement
- All personal information collected through this journal’s website — including authors’, reviewers’, and readers’ names, email addresses, or institutional affiliations — is treated with strict confidentiality. This information is collected solely for editorial, peer review, and publication processes, and is not shared, sold, or used for any unrelated purposes.
- Zagazig Veterinary Journal is committed to protecting the privacy of its users and complies with relevant data protection standards. Access to user information is restricted to authorized editorial staff and is handled responsibly and securely.
11. Article Processing Charges (APC)
- As an open access journal with no subscription fee, authors (or their institutions or funders) are required to pay an Article Publishing Charge (APC) to cover publication costs. This fee ensures that your article will be freely accessible to all readers immediately and permanently.
- For publication in Zag. Vet J., a total of 2000 Egyptian Pounds (100 US dollars for Non Egyptians) are required as Articles submitted from 10 September 2025 based on the University Council Decsion Number 591 on 25/8/2025, Besides 600 Egyptian Pounds for reviewing.
12. Contact Information
Editor-in-Chief: Prof. DR. Amal A. M. Eid
Avian and Rabbit Diseases, Faculty of Veterinary Medicine, Zagazig University, Sharkia, Egypt
Phone: 0552288204-231, +20 10 95242016
Email: zvj@vet.zu.edu.eg
amalaeidvetgmail.com
Associate Editor-in-Chief:Prof. DR. Heba Ahmed
Professor of Zoonoses, Faculty of Veterinary Medicine, Zagazig University.
Phone: 0552288204-231, +201012229002
Email: zvj@vet.zu.edu.eg
heba_ahmed@zu.edu.eg
hebaahmedzu@gmail.com


